Part:BBa_K1680015:Design
pRS315 yeast shuttle vector with Biobrick MCS
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3171
Illegal XbaI site found at 3156
Illegal SpeI site found at 3148
Illegal PstI site found at 3134 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3171
Illegal SpeI site found at 3148
Illegal PstI site found at 3134
Illegal NotI site found at 3139
Illegal NotI site found at 3163 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3171
Illegal XhoI site found at 2410 - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3171
Illegal XbaI site found at 3156
Illegal SpeI site found at 3148
Illegal PstI site found at 3134 - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3171
Illegal XbaI site found at 3156
Illegal SpeI site found at 3148
Illegal PstI site found at 3134
Illegal NgoMIV site found at 2799
Illegal AgeI site found at 1503 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI.rc site found at 4545
Illegal SapI site found at 3462
Illegal SapI site found at 5566
Design Notes
This part is derived from the pRS315 vector (Sikorski 1989). It is mutagenised to be compatible with RFC10 and the wild type MCS was switched for a RFC10 MCS. The biobrick MCS is flanked by ApaI (Prefix) and SacI (Suffix) restriction sites. These can be used together with either EcoRI or PstI site to introduce a promoter or terminator stably into the vector without disturbing the RFC10 standard.
Sequence of the new RFC10 MCS:
GGGCCCACGTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGACGTGAGCTC
Source
Derived from pRS315 Part:BBa_K950010 (Sikorski 1989).
References
Sikorski, Robert S., and Philip Hieter. "A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae." Genetics 122.1 (1989): 19-27.